Genetics and Molecular Biology

Nancy Cox

Jamaica High School, Queens

Summer Research Program for Science Teachers

August 2008

 

 

CONCEPT

Biotechnology

GRADE LEVEL: 9TH and 10th Living Environment

 AIM

How can we simulate the production of a recombinant DNA plasmid?

 EXPECTED TIME

One class/lab period (~ 45-60 minutes)

 PERFORMANCE OBJECTIVES

Students will be able to:

·  Demonstrate the synthesis of a DNA plasmid by using a paper model.

·  Explain the significance of the new plasmid in terms of its expression of the new traits.

·  Explain the importance of restriction enzymes, polymerases and ligases in the   

    formation of a recombinant DNA.

 PRIOR KNOWLEDGE

Students would have discussed the basic units that make up DNA, DNA replication, transcription, translation, and gene expression.

 MATERIALS

Yellow and orange construction paper scissors, cellophane tape.

 MOTIVATION

Tell the class that in this exercise they will simulate the process by which molecular biologists insert donor DNA (genes) into bacterial plasmids so that the bacteria will then be able to replicate and express those genes.  This procedure has made it possible to produce large quantities of many important human proteins relatively quickly and inexpensively.

 DEVELOPMENT

1.  Working in cooperative learning groups, have the class cut pieces of yellow construction paper into one inch strips lengthwise.

 2.  Tell them to tape the strips end to end to form one long, continuous strip.

 3.  Ask the class to copy the following DNA code onto their yellow strips, making sure that the entire code fits onto the strip, adding more paper if there is not enough space.  (Have them trim off any excess paper.)  This will represent the donor DNA.

 YELLOW:

ATTCATACAGGATCCAAGCGATTCGACTATCGCCATGGATCCAAACCGTTACGA

TAAGTATGTCCTAGGTTCGCTAAGCTGATAGCGGTACCTAGGTTTGGCAATGCT

 4.  Have the class cut pieces of orange construction paper into one-inch strips lengthwise.

 5.  Tell them to tape the strips end to end to form one long, continuous strip.

 6.  Ask the class to copy the following DNA code onto their orange strips, making sure that the entire code fits onto the strip, adding more paper if there is not enough space.  (Have them trim off any excess paper.)  Tape the two ends to the strip together to form a loop.  This will represent the plasmid vector DNA.

 ORANGE:

GCGCCCTGAGGATCCATATCCGCATCTACT

CGCGGGACTCCTAGGTATAGGCGTAGATGA

 7.  Tell the class that the restriction enzyme BAM HI recognizes the following sequence in DNA and cuts the molecular backbone according to the following:

                         G|GATC C

                         CCTAG˝G

 8. Have the class assume they are cutting both the vector and donor DNA with Bam HI.  Tell them to search through the codes on their strips until they find sequence above.  This is the enzyme’s restriction site. Tell them to use their scissors to make the cut as shown in the diagram above. 

9.  Tell the class that they now have an open vector (orange) and a piece of DNA (yellow) that was cut by the donor.  This latter piece of DNA has a gene that we wish to insert into the vector (plasmid).

10. Have the class note the open ends of the plasmid, as well as the ends of the donor DNA.  Tell them to observe that the base sequences are complimentary.  These are called sticky ends because the complimentary base pairs have an affinity for one another in the presence of the proper polymerase enzyme.  Have them match the sticky ends on the plasmid with the sticky end on the donor DNA.  Inform the class to use the cellophane tape to splice the donor DNA into the plasmid.  They will now have constructed a recombinant DNA plasmid.  This plasmid will now express the newly incorporated genes when the plasmid is taken up by a bacterial cell.  In addition, the plasmid will be replicated many times within its bacterial host.  Thus the donor gene’s expression is magnified many times.

SUMMARY

Explain the following:  DNA plasmid synthesis; the role of the restriction enzyme, polymerase, and ligase.

  

APPLICATION/FOLLOW-UP/HOMEWORK

1.      Why do scientists insert genes from other organisms into bacteria?

2.      Why must the same restriction enzyme be used to cut the plasmid and the donor DNA?

3.      In the simulation, what is represented by the scissors?  What is represented by the cellophane tape?

4.      Besides taking up the donor DNA, what else may happen to the open plasmid?  How would this affect the outcomes of the transformation experiment?

 

NEW YORK STATE SCIENCE STANDARDS

Standard 1:  Key Idea 1, Performance Indicators 1.1(a-c) and 1.2 (a&b)

Standard 4:  Key Idea 2, Performance Indicator 2.2 (a-e)