Restriction Digest + DNA Comparison

2 day lesson or 2 periods- 50 min. 2^nd day should be in conjunction with Relationship and Biodiversity lab

Before doing this activity, students should already have been introduced to enzymes and their role as catalyst for reactions. Also, students should have a good knowledge of DNA structure and function.

Students will be able to do a restriction digest and understand its uses in the biological field

Students will be able to run a gel electrophoresis to better understand the Relationship and Biodiversity lab

Restriction digest of plasmid pDsD/ie123/ph1/pycrt using 3 different restriction enzymes

plasmid DNA pDsD
Restriction enzymes: SacI and HincII
micropipet 20 uL and pipet tips
3 gel box with power source
DNA Marker 1kb+
BSD - for restriction digest
buffer 4 - for restriction digest
water
UV light/gel camera - consult the lab nearest you
scissor for each group
DNA sequences in paper (should be ready):

ATCCGGACGTCCGGTTTTTTT

CAGTCCGGAACGTCCGGATG

AAAAACGGATGCCGGATCGC

CAAATCTCCGGACCGGAGTC

Order of events for the class, time allocated per event, prep work needed, materials needed.

I. Do Now (5 minutes): What is an enzyme? Give examples of where enzymes play a role.

Illicit answers from students and discuss the specific roles enzymes do. Also bring up the idea that most enzymes’ names end with –ase and have something to do with the molecule’s name it is attached to (ie. lactase - breaks down lactose)

II. Introduce Restriction Enzyme (RE)(10 minutes) – specific enzyme that cuts specific sites of the DNA. To help better explain the concept, use an analogy of a scissor. Print out a fragment of DNA, single sequence DNA of 20 bases with 2 sites that have CCGG. Explain how in a sequence of DNA, there can be a restriction enzyme that looks for CCGG and whenever it finds the site, a cut is made between the C and the G.

Restriction Enzyme activity (10 minutes): In each table, students in their group will be given sequences of DNA:

Each group will also have a pair of scissor labeled Restriction Enzyme using tape. This label is very important! (can be use as a reference during the year to remind students.)

Allow students to have 5 minutes to find the specific CCGG sites on their DNA sequence and once ready do the cut. Walk around to check and see if students have done it right.

III. (20 minutes) After students have gone through the quick RE activity, pose the question: What role do restriction enzymes play? Should call on 2 students for the right answer, to cut the DNA in specific sites.

a. Introduce the restriction digest activity. Student will be provided restriction enzyme and DNA. Post in each table a print out of the plasmid and the different restriction sites. SacI cuts the DNA in two sites while HincII cuts in one site. Ask students to make predictions of how big the fragments will be after the cut of each enzyme as well as a cut using both together. –Illicit and write on the board.

b. Students will be cutting the plasmid DNA (students should know about plasmid in a previous lesson) with 2 different restriction enzymes: SacI and HincII. All materials should be prepared ahead of time.

Each group will have in their table a 20micropipet, 5 microliter plasmid DN , 10 microliterSacI, and 10 microliter of HincII, 1 ml of water.

In 3 small eppendorf tubes, add 2.5 microliter of water, 2.5 microliter of BSA buffer and 2.5 microliter of Restriction buffer4.

Pipet 2.5 microliter of SacI in the SacI tube, 2.5 microliter of HincII into the HincII tube and 2.5 of SacI and HincII in the third final tube.

IV.(10 minutes) During the wait period, go over gel electrophoresis. Show a 10-minute mini-powerpoint on gel electrophoresis. (see attached powerpoint slides) Main points to go over are the properties of DNA and why gel electrophoresis is a perfect fit for separating DNA. What it can be used for? Compare different organisms – mention practical applications such as paternity test and Crime Scene Investigation.

V.(10 minutes)After mini lesson on gel electrophoresis, students will get their restriction digests and pipet into the gel.

Pipet 10 microliter of loading dye into each tube, resuspending each time. Careful to change tip each time to not contaminate each sample.

Pipet 10 microliter of DNA ladder 1kb+ into the leftmost well of the gel. One group will load their gel in the next well after the marker. (A group member should draw the gel and mark where their samples were loaded. Show an example on the board) this is designed to be in 2 gel boxes so students will share the wells.

After each group loaded their samples, connect the negative and positive cords to the powersource and run gel at 120V. Tell students that you’ll stop the run when the dye from the ladder reaches ¼ away from the end. They’ll see their results tomorrow.

VI. (10 minutes) Wrap-up: 3-2-1 exit pass - On a hand-out for each student should fill out the following:

Do Now: Write down 2 observations you see from the results of your sample. Describe the differences in where you see the DNA for SacI, HincII and SacI and HincII?

Go over the results of each group. Show the example of what the correct results should and discuss the reasons why groups who didn’t get the result got no result. Go over the steps taken during the digest and running the gel. See attached picture of correct gel run.

What size DNA was the result of the HincII digest? Was their prediction correct?

What size DNA was the result of the SacI + HincII digest? Was their prediction correct?

Explain the results you see. Why do you have 1 DNA band, 2 DNA bands and 3 DNA bands? This question should show whether the students have a general understanding of the gel.

The remainder of the class will be spent on finishing the Relationship and Biodiversity lab, test 7-Gel electrophoresis. This section of the lab is the paper scissor version of the gel electrophoresis lab. It’s a perfect set-up to describe the differences and similarities of the actual restriction digest and the actual gel electrophoresis activity they did.

Characteristics produced by the segments of DNA may be expressed when these segments are inserted into new organisms, such as bacteria.

2.2d Inserting, deleting, or substituting DNAsegments can alter genes. An altered gene may be passed on to every cell that develops from it.

2.2e Knowledge of genetics is making possible new fields of health care; for example, finding genes, which may have mutations that can cause disease will aid in the development of preventive measures to fight disease. Substances, such as hormones and enzymes, from genetically engineered organisms may reduce the cost and side effects of replacing missing body chemicals.